Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig72
Contig Information
Length 261 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10d01    rwhsh10d01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Aspergillus terreus NIH2624] >gi|114187705|gb|EAU29405.1| predicted protein [Aspergillus terreus NIH2624]
Score 74
Evalue 7.9348
Total Hit Count 1
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig72
GGCACGAGGCAGGGGTTGGGTGATCCCCACCCCTCACCTAATCCCCACTAATTCCTTCACCCCCACAATCCCTCTACTAAATCACTGCTCGGTTAAACCT
CTTGCCCCTCGGGGAGATTTGAATTGTGCATTGCTGTCACAGTGTAGCGGCAACGGTGAAACATTTGGAGTTACAACAACGGCATGCCCAACTGAATTTA
CAGTAGAACACATGTACTGAACCAGGGGCACATATTCAGCATTTCATACACNANAAAAAAA
page-top