Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig71
Contig Information
Length 260 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10c22    rwhsh10c22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to chemokine (C motif) receptor 1 [Monodelphis domestica]
Score 76
Evalue 4.66801
Total Hit Count 1
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig71
GAGGCTGCCCTGGAGAAGGACTATGAAGAAGTTGGTGCTGAGTTCGACGAGGGTGAGGATGGTGATGAGGGTGATGAGTACTAGAGCAGCTGAGATTGCG
ACCTGATGATCTGCCCGAGTGGCTTTATCTGTTTTCTGTCTGTTTGAATTGAATGTTTGCTGTGTGGTGTTTGGTTTACAACCTGTTGTGTTGTATGAAC
CTGCTTCGCACCTTGGTCAATATGCATGTTATCCGGTTTGCCTACACCATAAAAAAAAAA
page-top