Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig69
Contig Information
Length 273 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10c09    rwhsh10c09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0155100 [Oryza sativa (japonica cultivar-group)] >gi|62701652|gb|AAX92725.1| F-box domain, putative [Oryza sativa (japonica cultivar-group)] >gi|77548733|gb|ABA91530.1| F-box domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644492|dbj|BAF27633.1| Os11g0155100 [Oryza sativa (japonica cultivar-group)] >gi|125533450|gb|EAY79998.1| hypothetical protein OsI_35167 [Oryza sativa Indica Group] >gi|125576260|gb|EAZ17482.1| hypothetical protein OsJ_031691 [Oryza sativa (japonica cultivar-group)]
Score 129
Evalue 3.29126e-06
Total Hit Count 5
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig69
GAGGGCGGGAGGGGCTCGTCGACCTCTGCTGCTCCGGCGTCGGAGCGGCGGCGTTCGTCGGGTTCCTGGTGATGCTCACGTGCCGGTGAACGCGCGCGCA
TCGACTAGTAAAGGTTTGCTCACACGTGCGAGGAATGTGAATACGTGTTCGTCCAGTAGGTTACACTGGGACAGAGGGTCGCTGCCACAATGTAAATGTA
CTGTAGCGCAGGGCCAAGAGTTATCTTTTTTGCATTAATTTTCAGAAAGAGAAACTTGAGAAGAAAAAAAAAA
page-top