Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig68
Contig Information
Length 118 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9b02    whsh14d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Eremopyrum orientale]
Score 95
Evalue 0.0291203
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig68
GCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGAGCCGGTAGATACTATTGATAAGTAGATAAAACTAAAGATAAAGAAGAGAAGGTATAAATAAA
AAAGAAACAAAAAAAAAA
page-top