Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig67
Contig Information
Length 1229 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10c05    rwhsh10c05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSJNBa0065O17.11 [Oryza sativa (japonica cultivar-group)] >gi|116311120|emb|CAH68046.1| B0103C08-B0602B01.3 [Oryza sativa (indica cultivar-group)]
Score 670
Evalue 2.06488e-115
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig67
GGCTTGTGCATAGTCTGCATGCAATTTTTCTAATAGCAGGAGACAATAATAGTAAGAATATTTTGAACTTTGTGTTCATTTTGTCCGTAACAGGGGGCAA
GCAGAAACTAAAGTCTGGCCTATAATTATCAGTACTGTACTCGTATTAATGCCCTGTTCTGTAATTATCTTTTTAAGTTTTGATCATTAATGCATTATCC
TTTTCTTCAAACAAAACCATGTTTATATCTGTCTTTGTTATGTCCTCTGCTATAGTGCCAATAATATATCAAGTGCATCGGGAGCGTGATGGAACCAGCT
TTGCCACCAGAAAAGTGGAGGCAAAGCAGAAAGGCCTTGTTATGTTCACTTTAATTGTTTCTTTCCAGAAGGAAGAATTAGGGTTTGAGCATCAGGCTGC
AATCATGCCTGTCGTTCCTCCTCCAGAACAGCTCCTGAATATGGAGGAGATACGGGAAAGAAGACTCACTGATCCACGGTTTCCGATGCAATATAGGAAC
TCAGCTGCCAAGAAAAAGTTTGTACCTTGGCCCATTTGAAATGAGGTTCTGCCAAGATTCTAAATCTCAGCATGAACCAAGCCTGCATTATTGGTTTAGA
GCTAGAGGAAAACTTTCGGATGATCCAGCTCTGCATAGATGCGTTGTAGCATATGCTTCGGATCTACTATATTCAGGCGTCAGCCTAAATCCGCACCGTA
AGAGGGGTTTGAAGACATACTCTCTCAGTCTTGATCACTCGATGTGGTTCCACAAGCCTGTGAAAGCTGATGACTGGTTGTTATATGTGATCGACAGCCC
ATCCGCACATGGTGGCAGGGGATTCGTCACCGGACGTATGTTCAACCGGCAAGGAGAGCTTATTGTGTCGCTGACCCAAGAGGCGTTGATTAGGAGGGCC
AAGACACCCGGGCAAACCCCAAGGCCGAAGCTTTGAGATGTGCAGAAGAGCCATGGCTGTACTTTAATATTTTCTTTCCCCTTGCTGTTCCGTATTTTTA
TCTTATATAGTACACGGAGACAATGGTGAGATTTATGTATAGGAGTACAGCTTACAGCTTGAATTTGGCACACATGTGAACGATTGTATCCTCGCATGCT
GATTCACATTCAGGTTTTCCTTTGCATATGTGGATGGCAATTGCCATCCAACACGCGGCACATGAATGTAGACAGATGTACCTCAAATTCAAAGTTTTGC
AATCCTGAGGTCATGTAGTACCATTCAAA
page-top