Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig66
Contig Information
Length 518 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10b21    rwhsh10b21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11024 [Oryza sativa Indica Group]
Score 408
Evalue 1.76879e-38
Total Hit Count 114
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig66
GCCTCGTGCCGAATTCGGCACGAGGACGCTGCCCCGAACCAGATACCAACGATCTATGAAATGCAAGAGCGTACGGTGGATGGCAGGAACTACTGGACAT
TTGAGTACGATCTGGAGGCGCCGGGCTACGGCGTGTCGGCGTTTGCGACGGTCGCCATCGGAAACGGGAGGTACTACACGCTGATCGTGACGGCGAACGA
GCGGCGGTGGAGCAGGCTGCGCAACAGGCTCAAAGTCGTCGCCGACTCCTTCAAGATCTACGACTTGAACGCCTGATTGCGCAAGCTCTTGATGTCCGTC
GGCACCATCCGACCGTTGCAACGCGGGCGAAACCTGGTGTCACGGCCTGAGGCCGGAGGAACCCAACTCAACGAATCTGCATTGCTCATACATCGAGCTA
TTCAAGCTTGTACGAATCTAGTAGAACCAGTATGCATGAATTAGTGGTCAAAATTTACTTCTTTAAAACCATATTGAGGATCCAGAGGGAGTATGATCCT
AGGACAGTTCGTCAAAAA
page-top