Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig65
Contig Information
Length 252 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh2a06    rwhsh2a06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100191398 [Zea mays] >gi|194688794|gb|ACF78481.1| unknown [Zea mays]
Score 113
Evalue 0.000232818
Total Hit Count 25
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig65
CGAGGGGGAGAACAGCGCCATCTTCAATGTTCCCCATGAGAGCCTGCTGAATGTTGGGCAGGTGTTCTATGTGTAGCTAAAGTGGATGTAAATTACTGTG
TTTGTGTGTAGATTATTTTACAGGAGAACTCTACAGAAATGATGATTAATTGATTTTACATATCTGGAACATGTAGATTTTAGTACTAATAAAATGGCAC
ATGTAAATTTTAGTAATAAAATGGCAAATTTCAGTGCTGTGCAAAAAAAAAA
page-top