Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig64
Contig Information
Length 242 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10b18    rwhsh10b18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain 4, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390381|pdb|2J37|4 Chain 4, Model Of Mammalian Srp Bound To 80s Rncs (no hit)
Score 431
Evalue 3.10672e-41
Total Hit Count 0
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig64
CGAGGCGGGCGATCACTATGTACTGAATTATCTCTTGAATAATCCTACCTCGAGATCAGAATATGTAAATGGTTAATTAGTGGTGATGAAATTCAGCTAT
GCTTCTATTTTTATTGTTGTTTTATTTTGATTTTGGTACTCCAATGGTTTGCTTAGATGTCTGTGTAAGAAGCAAACTTGTGTGATTTGACTGCTTCCTG
TCATCTACCTACAAAAATGTATATTCTGAGCTAAAAAAAAAA
page-top