Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig63
Contig Information
Length 487 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10b16    rwhsh10b16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain 4, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390381|pdb|2J37|4 Chain 4, Model Of Mammalian Srp Bound To 80s Rncs
Score 431
Evalue 3.10672e-41
Total Hit Count 449
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig63
GGTCCAAGGCCAGGGACCCCAAGTACCCCAGGATCAGCACCCCTGGGAGGAACAAGCTCGATCAATATCAGATCCTCAAGTACCCGCTTACCACTGAGTC
TGCAATGAAGAAGATCGAGGACAACAACACACTCGTCTTCATCGTCGACCTGAAGGCCGACAAGAAGAAGATTAAGGCCGCTGTCAAGAAAATGTACGAC
ATTCAGGCCAAGAAGGTTAACACCCTCATCAGGCCTGATGGCAAGAAGAAGGCGTACGTGAAGCTGACACCAGACTACGATGCTCTTGATGTGGCCAACA
AGATCGGCATCATATAAGTCAGAGGGAGGGTCCTGCAGTAGGCGCTTGTGTCGTGGTTTCTTATGTTATTGGAATTTTGTAGTTGTTACTTAGCAAAGGG
GCTCGGTGGCTCCATTGCCTACCATATCGCCGCACACTTTCATGAATTTGATGCAATCGAAGTGACTTGTTGATGCTAAAAAAAAAA
page-top