Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig62
Contig Information
Length 663 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh10b14    whsh10b14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PW9, chloroplastic; Short=RuBisCO small subunit PW9; Flags: Precursor >gi|170771|gb|AAA34302.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 671
Evalue 1.05489e-68
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig62
GGCCAATTGAGGGCATCAAGAAGTTCGAGACCCTGTCTTACTTACCACCCCTCTCCACGGAGGCCCTCCTGAAGCAGGTCGACTACTTGATCCGCTCCAA
GTGGGTGCCCTGCCTCGAGTTCAGCAAGGTTGGCTTCGTCTTCCGTGAACACAACAGCTCCCCCGGGTATTATGACGGTCGATACTGGACAATGTGGAAG
CTGCCTATGTTCGGGTGCACCGACGCCACACAGGTGCTCAACGAGGTGGAGGAGGTTAAGAAGGAGTACCCTGATGCGTATGTCCGCGTCATCGGCTTCG
ACAACATGCGCCAGGTGCAATGCGTCAGCTTCATTGCCTTCAGGCCACCAGGCTGCGAGGAATCTGGCAAGGCCTAAAGTGCAAGTTGAAGTAACCGATA
TACATGTCATGTTAGTCAAATTTGTCGGCGGCTCTGCTTTCTCAGTTTTACTTCTCGTTCTACTCATATGTGAATATATGAGCATATGTATGTAAGCACC
TACCAATGTAGGTCGAGGAGGATGCATATGAGAATTATAGCACCGGCTATACATATACATATATATTATATGCAATCAACGGATTAGTGTCTTGCCATCA
ATTGATGGAAATGTTACTTTCTTTGCAGCCGGAAATGCCTATGTCTTGCATTGTTTTCTTCTC
page-top