Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig60
Contig Information
Length 825 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10b09    rwhsh10b09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BMULJ_05092 [Burkholderia multivorans ATCC 17616] >gi|189337865|dbj|BAG46934.1| hypothetical protein [Burkholderia multivorans ATCC 17616]
Score 207
Evalue 3.42032e-32
Total Hit Count 75
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig60
ACTGTTTCGGCAAGGGGGTCATCCCGACTTACCAACCCGATGCAAACTGCGAATACCGGAGAATGTTATCACGGGAGACACACGGCGGGTGCTAACGTCC
GTCGTGAAGAGGGAAACAACCCAGACCGCCAGCTAAGGTCCCAAAGTCATGGTTAAGTGGGAAACGATGTGGGAAGGCCCAGACAGCCAGGATGTTGGCT
TAGAAGCAGCCATCATTTAAAGAAAGCGTAATAGCTCACTGGTCGAGTCGGCCTGCGCGGAAGATGTAACGGGGCTAAACCATGCACCGAAGCTGCGGCA
GCGACGCTGATGCGTTGTTGGGTAGGGGAGCGTTCTGTAAGCCTGCGAAGGTGTGCTGTGAGGCATGCTGGAGGTATCAGAAGTGCGAATGCTGACATAA
GTAACGATAAAGCGGGTGAAAAGCCCGCTCGCCGGAAGACCAAGGGTTCCTGTCCAACGTTAATCGGGGCAGGGTGAGTCGACCCCTAAGGCGAGGCCGA
AAGGCGTAGTCGATGGGAAACTATGTTGGCCGGGCGACGGTTGTCCCGGTTTAAGCGTGTAGGCTGGTTTTCCAGGCAAATCCGGAAAATCAAGGCTGAG
GCGTGATGACGAGGCACTACGGTGCTGAAGCAACAAATGCCCTGCTTCCAGGAAAAGCCTCTAAGCATCAGGTAACATCAAATCGTACCCCAAACCGACA
CAGGTGGTCAGGTAGAGAATACCAAGGCGCTTGAGAGAACTCGGGTGAAGGAACTAGGCAAAATGGTGCCGTAACTTCGGGAGAAGGCACGCTGATATGT
AGGTGAAGTCCCTCGCGGATGGAGC
page-top