Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig59
Contig Information
Length 425 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10b02    rwhsh10b02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glucose transport protein STP1 [Oryza sativa Japonica Group] >gi|50508996|dbj|BAD31945.1| putative glucose transport protein STP1 [Oryza sativa Japonica Group] >gi|215704477|dbj|BAG93911.1| unnamed protein product [Oryza sativa Japonica Group]
Score 399
Evalue 1.63457e-37
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig59
AGGGTCGGTCAACATGCTCTTCACCTTCGTCATCGCGCAGGCGTTCCTCACCATGCTCTGCCACATGAAGTTCGGCCTCTTCTACTTCTTCGCCGGCTGG
GTGGTCATCATGACCGTCTTCATCGCGCTCTTCCTGCCGGAGACCAAGAACGTGCCCATCGAGGAGATGGTGCTCGTCTGGAAGGGCCACTGGTTCTGGC
GCAGGTACATCGGAGACGCTGACGTCCACGTCGGCGCCAACAACGGCAAGGGCGCCGCCATCGCATAGATTCCTTCCTTCCTTCCCTAGCTCCGTCTCCC
TCGTGTACATTAATTGCTTTTCTTCCTCTCTTCCTTGTTTGTCCTCGTACTTAGGTCAAACCGTGTGTTTCTGTATGTGCTTCAAGATTCTTGCATTAAT
TAAGATAGTACCATCAAAAAAAAAA
page-top