Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig58
Contig Information
Length 667 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10a24    rwhsh10a24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0616900 [Oryza sativa (japonica cultivar-group)] >gi|33146865|dbj|BAC79863.1| senescence-associated putative protein-like [Oryza sativa Japonica Group] >gi|33146944|dbj|BAC79992.1| senescence-associated putative protein-like [Oryza sativa Japonica Group] >gi|113611815|dbj|BAF22193.1| Os07g0616900 [Oryza sativa (japonica cultivar-group)] >gi|125559178|gb|EAZ04714.1| hypothetical protein OsI_26875 [Oryza sativa Indica Group] >gi|125601088|gb|EAZ40664.1| hypothetical protein OsJ_024147 [Oryza sativa (japonica cultivar-group)]
Score 424
Evalue 4.03763e-57
Total Hit Count 232
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig58
GGGATCATGGTCTGCGCCATCAGCGATTTTATCTGTTGGATTGGGATGGGGAGTGCAGATTGGAGGAGAATTGACAGATTTTATAATTGTGCTTCATGAT
CTTAAAGCTGTCAAGGCATTCAAGCAGCCGCATGCATCTTTCTCTTGGGGCAGGATTGAGTGCGGCAGCAGGACCAATTGGCAGAGCCCTTGAAGCAGAT
GTTCGAGCAAGTGAAAAAGGTTCTGGGATATGCTACACTTATAGCTGCAGCAAAGGTGCCTTTGTTGGGGTCTCCCTTGAAGGAAATGTCGTGACAACAA
GACCAGACACCAATCTGCGCTTCTATGGGGACGCCTACGTGACCACGACCGATATCCTGTTTGGGAGGGTGGAGAAGCCCAGAGCTGCGCAACCCTTGTA
CTCGGCTCTCGATGATCTGTTCTCAAAAATGGTTTGCTAGTTCTAGCCATTGTAGTCTCAGCATTCAGCGGTGTACATATATCTAAAATATGCTAGGAAC
AGTCCTTGGGAGAAAATATCCCAGAAAAAAATGTACAGCTTTTATTGGGTGGGTTCACTGCAAGTATGTGTCCACGCATGTAAATATTGTCAGGAGATCA
CTATGTTATCCGCCGTCGTGGCTTGATTATTGCAGTGTGATGCTGTTAAAATATTTCAAAAAAAAAA
page-top