Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig57
Contig Information
Length 449 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh2a18    rwhsh2a18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Grx_S2 - glutaredoxin subgroup III [Zea mays]
Score 135
Evalue 6.68275e-07
Total Hit Count 85
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig57
ACGAGGCGGCGGGCTCGACCGGCTCATGGCCGTGCACATCTCCGGCGAGCTGGTGCCCATACTCAAGGACGCCGGCGCGCTCTGGCTCTGAGCCTACTCT
GAGCAAAATCAAAGATGCATGCCGGACGGGGTACTACGGACGTACGCACAACCGTTTGATCAGGAGTTAATCTTTTCTCCTTCTTTTGATTTCTCCTTTT
GACTCTTGAGATCATGTGAGTTACTGCTGCTCGATCTCCAGTCTCTCTTGATTGGGATCAATAATGAAGTACTACCACTAGCTAGCTATATATAGTTAGG
CTTAAATTCTTTTGATTAGGGGTGGAAAAAATAGGAACTATTGTGCCATCTCGTGCTTATTTTCGACCACACGCTTGTAAATACATGGATGAGTGAAGAG
GGGTGTACTATTTAGCACTGTATAAATCATGTTCCTTTCNNAAAAAAAA
page-top