Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig53
Contig Information
Length 617 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10a03    rwhsh10a03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative rubisco small subunit [Triticum turgidum subsp. durum]
Score 622
Evalue 4.30206e-63
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig53
GAGGCCTGTCTTACTTGCCACCCCTCTCCACGGAAGCCCTCCTGAAGCAGGTCGACTACCTGATCCGCTCCAAGTGGGTGCCCTGCCTCGAGTTCAGCAA
GGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCCCCCGGGTACTACGACGGTCGATACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACCGACGCC
ACACAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGCGTCATCGGCTTCGACAACCTGCGCCAGGTGCAGTGCGTCA
GCTTCATCGCCTTCAGGCCACCGGGTTGCGAGGAGTCCGGCAAGGCCTAAACTATGAGTTGAAACAATGGCCTATCTCATATGAAGATCTTTTGTGAATT
TCACTTTTGTCCACGACCTCTGTTGCACGACTCTGCTTTCCGACCGGAGCATACCTTTTGTTCTATATGATTTGTGTATGTATGTAGGAACCTATGTTCT
CGAGCATGCATACATAATTCCTCATAGGTCTATATACACCGGCTATCCATATGCAAAACCTGTGTAATATTTGTTATATACAACACGCGGACCATTGTCT
TGCTGTTAAAAAAAAAA
page-top