Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig52
Contig Information
Length 826 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9p24    rwhsh9p24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0356300 [Oryza sativa (japonica cultivar-group)] >gi|108708222|gb|ABF96017.1| 50S ribosomal protein L6, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548610|dbj|BAF12053.1| Os03g0356300 [Oryza sativa (japonica cultivar-group)] >gi|125543898|gb|EAY90037.1| hypothetical protein OsI_11607 [Oryza sativa Indica Group] >gi|215692529|dbj|BAG87949.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1028
Evalue 6.58588e-110
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig52
ACCCGAAGAAGAAGAAGAAGCGCGCACACCGAGCGAGCGGCGGCAACACGGAGCCCGTCCATGGCGTCCCTCTCCCCCTCCCTCCACCTCCCTTGCAATT
CAAGAATTGGCTTCCTTGGGAAGTCACAAGGCATACTTCTTCGTGTTATCCCTGCTGGCAGAGTTGGTTTCATTAGAAAAACAGTGGAATGCAAGGAATC
TAGAATCGGAAAGAAGCCGATTGAAGTTCCATCAAATGTTACTCTAACACTAGAGGAGCAGTTTGTCAAAGCTAAGGGTCTACTAGGAGAGTTGACATTA
AACTATCCCGCCGAAGTAAAAGTTGTGAAAGAAGAGACTGGCAAATTGAGAGTATTCAAGACTGTGGAAACCAAAAGGGCGAATCAGATGCATGGCCTTT
TCAGAACCCTGACGGACAACATCATCGTGGGGGTGTCAAAAGGATTTGACAAGAGGCTTCAGTTAGTGGGGGTTGGGTACCGTGCGACGGTGGAGGGCAA
AGACCTGGTGATGAACCTGGGATTCTCGCACCCTGTCCGGATGGCTGTCCCAGAAGGACTTCAAGTCAAGGTGGAGGAGAACACGAGAATCATCGTGAGT
GGGTACGATAAGAGCGAAATCGGCCAGTTTGCTGCCACCATAAAGAAGTGGAGGCCTCCGGAGCCATACAAGGGGAAGGGTATCCGGTACCAGGACGAGA
TTGTCAGGAGGAAGGAGGGCAAAGCTGGGAAGAAGAAATAGAAGGCTGTTTATTTATTTGTTTGCATTTCTTACGTACTTTTGTTCTGTTTTCCCTCTGT
AATCCGCCATCTTCCGAGTACTACCA
page-top