Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig51
Contig Information
Length 184 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh2e15    rwhsh2e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to KLHL23 protein, partial [Homo sapiens] (no hit)
Score 74
Evalue 7.74098
Total Hit Count 0
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig51
CGAGGTTTTGGGGTTCATCATGTGATGTTTTTCTCCGGCGATTTGGTGTCGATGAACCATGCGCTCTTGTACCTGTTGAATGTCTCGGCCATGTTTCGAT
TTGGTGTCACGTCTTAATTTGTTTCCTTGATCTGTGGGTACATAGCCATCAATAAAAACGTCTGCTCTGTTGATAAAAAAAAAA
page-top