Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig50
Contig Information
Length 219 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh2f01    rwhsh2f01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to KLHL23 protein, partial [Homo sapiens]
Score 74
Evalue 7.74098
Total Hit Count 2
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig50
CGAGGCCTCGTGCCGAATTCGGCACGAGGGCAAGTTGAAGTAACCGATATACATGTCATGTTAGTCAAATTTGTCGGCGGCTCTGCTTTCTCAGTTTTAC
TTCTCGTTCTACTCATATGTGAATATATGAGCATATGTATGTAAGCACCTACCAATGTAGGTCGAGGAGGATGCATATGAGAATTATAGCACCGGCTATA
CATATACATAAAAAAAAAA
page-top