Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig47
Contig Information
Length 589 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh2f12    rwhsh2f12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0468400 [Oryza sativa (japonica cultivar-group)] >gi|47497322|dbj|BAD19363.1| putative membrane related protein [Oryza sativa Japonica Group] >gi|113536353|dbj|BAF08736.1| Os02g0468400 [Oryza sativa (japonica cultivar-group)]
Score 290
Evalue 2.53447e-33
Total Hit Count 14
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig47
CGAGGCTGGCCTTTTCCAAGGGCATCTGGAATTATATTTGTAAGATGAACAATGCTTTACGCCGGTATCCTCCAGCAGCGTGGTCCGTCGATATCAATTT
CGACCATGCGAAGACTTACCAAGAAGTTTCCCCAGGACTTGCAGAGCAACGTGGATGAAAGTAATCGATCTCCAGTGAATACAGCTGCGGCTGTTGCTCC
TCCTACACCTTCATCCGGAACTTCTCCCTGCAAGCAGCTAGGGAAGAAGTCATCACGGGAAACGATTGCAAGTGGACTTTTGCTAATTGGAAGCATCGTT
TGTCTGTCGAAAGGCCGATCTAACCTCGGCGCACAGCTTGCCATGGCATTCTTCCTGAAGAAGGCCTTTAAGCAGGACAAAGAACCAGGCTCTTCGCCAA
GGGGAAGAACTGATGCGACGGTGCCCATGCAGTAGTAGTAGGACTGGCTTAAGCTGTTGATGCTACCGTTTTATCCTTACAAACTGAGTACTTACTACTT
ACATGAAATTGAAAAGGCATGATTGTACAGCGTTCTTGGCCGCAAATTATGTAAATGACAAGTTTTGAAATAACTTTTGTTCTCCATTT
page-top