Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig46
Contig Information
Length 280 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9p08    rwhsh9p08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit killer cell lectin-like receptor subfamily A, member 1 [Sus scrofa] >gi|30267432|gb|AAP13541.1| Ly49 [Sus scrofa]
Score 78
Evalue 2.67019
Total Hit Count 2
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig46
CGAGGTGAACCTCTATTTCAAAGACCCCAGTAGTAGCCACTACGTCGGCGCTATTGCATATTCTGCAGAAATGTATCTTGGCTACCAATTTGTTGGAACA
ACTCATTTAGCTATTTTCGACAAATGAATTGGATAAAATAAGCACGTCTATGTTGTGGGCGTGCAGTAACGTGCTTATGTTGAATACAGTCAATATTCAG
TTCGAATGATGATCTGTTATTTTTTCAATCTTGTATTTATGAGAACCACAGCACTCTCTATTTTTCATGGAAAAAAAAAA
page-top