Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig45
Contig Information
Length 716 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh2g20    rwhsh2g20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit apoplastic invertase 1 [Hordeum vulgare subsp. vulgare]
Score 411
Evalue 2.38033e-77
Total Hit Count 428
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig45
GAGGCGGAGGCGCTGGACCCGGCGCTAGCCAACGACGCCCAGAAGCTGTGCAGCGTGAGGGGTGCCGACGTGGAAGGCGGCGTGGGCCCCTTCGGTCTGT
GGGTGCTCGCCTCGTCCAAGCTGGAGGAGAAGACGGCGGTCTTCTTCCAGGTGTTCAAGGCCGCGCGCAACATCAACAGCACCAAGCCGGTGGTCCTCAT
GTGCTCCGACCCCACCACGTCATCTTTGAACCCGAACCTCTACAAGGCCGACGTTCGCAGGCTTTGTTGATACTGACATAGCGAAGGGCAAGATATCTCT
GAGGAGCCTGATTGATCGGTCCGTCATCGAGAGCTTCGGGGCAGGAGGCAGGACCTGCATCCTCTCCCGGGTTTATCCAACGCTCGCCCTAGGCAAGAAC
GCTCACCTTCATGTTTTCAACAACGGCAAGGCGGACATCAAGGTGTCACAGCTCACGGCGTGGGAGATGAAGAAGCCAGCGCTCATGAACGGTGCTTAGA
ATTTAGGGTGGATATCTACATGCAGGCTTCCTATACATGTGCCTGAATTTGGCTCACGTTCTGTTAAATTGGTCTCTGGTGAAACATGATTGGTCTGTGA
GGGTACGTATGTAGCTAGGTTTGCACGTAGTATAAGTGCACTACGAAGGGATCATTTTGCCCGTAGGAACAATAAAAGTTCTATGCATATTCTGTCGTGC
GCATTGGTNGAAAGTA
page-top