Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig23
Contig Information
Length 1077 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl1l24    rwhfl1l24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vesicle transport v-SNARE 13 [Zea mays]
Score 966
Evalue 1.56956e-102
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig23
tcatcgctgtctggaacagcgacccccctcgtgaagcagcccggatcgaattgcggtcgtctcgatcatccgctcgattcgacgccgccggacgatttgg
gcgcggaatccggaggggggtatctgtgcgcgcgggcggaggcgatcgaggggagcagccatgagcgaggtgttcgagggctacgagcgccagtactgcg
aggaatccgcctccctctcccgcaaatgcaccgccgcctccgctctcgatggagagaagaagaagcagaggctctccgagatccagtccggcgTGCAGGA
AGCTGAATCGCTGATTCGGAGGATGGACCTGGAGGCTAGGAATACGCCGCCGAGCGTGAAAGCGGGTTTGCTAGCTAAGCTGCGGGAGTACAAATCTGAC
CTTAACAACCTCAAGAGCGAGCTCAAGAGGATCTCGGCGCCCAATGCCAGGCAAACTACAAAGGAGGAGCTCCTTGAATCTGGCATGGCTGACACACTTG
CGGTGTCCACTGATCAGCGAGGAAGGTTGATGATGAcaactgaaagactgaatcagtccactgacagaattaaagagagccgaagaactatgctggagac
agaagaacttggtgtgtcgattcttcaggaccttcatcaacaacggcagtcactactgcatgctcacgatactttgcatggggttgatgataatgttgga
aagagcaagaaaatcctgtcggcaatgtcaaagaggatggacaggaacaagtggatcattggtggaatcatttcagctcttgttgtggccatccttatca
tactctactttaagctcgctcactgagccagccaggtaggtcctccaaattgtatgtgttcagtaaaattgtgtgataaggttgtctgaacgctgtacat
tggacgacacccaccgattgtccctcggaagttcattggttccccaaacatgtttataaatatttgatgagtggttcattggcatgtcatgtatagcaac
cactcgtgtcaggaggtcagttgtgcccgaccatattatgatgtaaaactgtgagaaaaacaaaagngaaaagaaga
page-top