Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig42
Contig Information
Length 625 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh9o15    whsh9o15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11492 [Oryza sativa Indica Group]
Score 534
Evalue 7.15604e-53
Total Hit Count 353
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig42
GCATTCAGTAGCTGTACAACCGAGACAATACAAGAAGCAACAGAGCTCACTAACTTGAATGCTTTTGACATCATTTCTCTTTCTTCTGGGTTTGATCTCT
CTGGCATGTTTGAGGATAAGTCCAACAAAGAGTCCAAATTCACATCTACCAACACAGCTGCAACAATCATCACAAAGCTTGAAGATATTGCAAAGCGCTT
GCGGCTAAGACTCATGAAGAGAGACGGTGGGTTGTTGAAGATGCAGAGCTTGCAACCGGGAAGGAAAGGCGTAATGTCCATAGATACCGAGATATTTCAG
ATTGCACCAAATTTTCATCTGGTGGAAATCAGGAAGACCAATGGTGATACTCTCGAGTATCAGAAGGTTAAACATGATATGAGACCGGCTTTGAAAGACA
TTGTTTGGGCTTGGCAAGGTGAGCAGCCCTAGTAATAGTGTGACTACTAAGTAAAGCGTAGAAGTTGCAAGAATGTGCAATGTTTACATGTTGGAATCAA
TAATGCACTTGTCTAATTTTTGTAGGTAGTTTAGTGTGTTCACTGTCATGTTTTTATTATGAAATGCTACTTCTGTATTGACCGTTATTCAATTGAAAAC
ATGACTATTTTAACTAAAAAAAAAA
page-top