Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig40
Contig Information
Length 1069 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9n20    rwhsh9n20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0681700 [Oryza sativa (japonica cultivar-group)] >gi|33146671|dbj|BAC80017.1| putative glycosyl transferase protein A [Oryza sativa Japonica Group] >gi|113612192|dbj|BAF22570.1| Os07g0681700 [Oryza sativa (japonica cultivar-group)]
Score 759
Evalue 1.56628e-78
Total Hit Count 310
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig40
ACATTTCTTTATTCCTGAAATATTCAAGGATCTAAAAAAGGTGGTTGTATTGGATGATGATGTGGTTGTTCAACGTGATCTGTCTTTCTTGTGGAAACTT
GATATGGGGGACAAGGTAAATGGTGCTGTTGAATTTTGTGGTGTAAGACTGGGTCAAGTGAGAAATCTCCTGGGTAAGACAAAGTATGATCCTAAATCAT
GTGCATGGATGTCTGGGGTGAATGTGATCAATTTGGATAAATGGAGGAAGCATAAAATAACAGAGAATTACCTGCTGCTCCTTAAACAGGTCAAGAAAAA
AGACGAGGTATCTCTGAGAGAAGCTGCCTTTTCTTTAAGCCTGTTGTCTTTTCAAAATCTCATCTACCCCCTTGATGGGAGGTCGACTCTGTCTGGACTT
GGATATGATTATGGAATCGATCCGGAGGTTGCACAGAGCTCTGCAGCATTGCACTACAATGGCAATATGAAGCCTTGGCTCGAGTTAGGCATACTGGACT
ACAAGAAGTACTGGAGGAGGTTTCTCACTCGAGAAGATCGATTCATGGATGAGTGCAATGTAAATCCGTAGCACACTTGATCAGAACTATCGACAACAGT
TTGAGACATCCACTGGCCTCCTCCTTTGAATCCTTCTCTGTCTGACTGGATGCCTGTAGCTCCCAAGAGTTGCACTGTCATTGGCTACCATCTACAACAA
ACTACACGCAGCAGTTGAACAGGAGAAGAGGTGCTGCCATTGGCTACCAGTGTCGACAGTATTGAGCAGACGCAGCATCATCTGCCCATTGCATTGAACA
GATTGATTGATGGTTTCGGGGTCTTGCGATTTTTTATGTAGCAGGTAAAGGATGATGTCTCGTTGTCCAGATTGTTTGGTCAGATCGTCGATGCAAAGAT
TCATTTCATATTTCTCTCTTTTGCCAATAAGGGCACACACATGTAATCTCATTTTTTTGGCTGTTAGCTGTAGCGTGGTGATTAATTTTTTGGGGTAGTT
CTGCGCCTGTGAAACTGTGGATAACCTGTATATTGTTTGCTATACTTCCTCGCGAGGGGCGCACTCATT
page-top