Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig38
Contig Information
Length 279 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh2h24    rwhsh2h24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_04988 [Oryza sativa Indica Group]
Score 255
Evalue 8.01235e-21
Total Hit Count 13
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig38
GGAAAAAGGTAAGCGTCTACCCATATGAGAAACAGCCTGAGAACCCAAACAGTTACAGAGCAAGGAAGAGAGAGAACTTCCGCTTGCAGCGCGAACGCTT
GAAAGCCAGAGCAGAGGGAACTTATGAACCAGAATTGGTGTTGGCAGCTGCAGATGCAAGTGTTGAGGTCAATGCAGACTGCTGATAGGTTTACTGTAAT
GTACTTCTCTTTTTACACAATACATGCTTGACAAATCTTTCTCGAATGTAAATCATCAACTGCAAGATGAAAAAAAAAA
page-top