Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig36
Contig Information
Length 727 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh2k18    whsh2k18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L11 [Triticum aestivum]
Score 673
Evalue 2.16484e-77
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig36
TGCACGAGGCCGCTGCCATGTCGACGGAGAAGAAGCAGCTGAACCCCATGCGGGGACATCAAGGTGCCAGAAGCTCGTCCTCAACATCTCCGTCGGCGAG
AGCGGAGATCGCCTCACCCGCGCCTCCAAGGTGCTGGAGCAGCTGAGCGGACAGTCACCTGTGTTCTCCAAGGCGAGGTACACTGTCAGGTCGTTCGGTA
TCAGGCGTAATGAGAAGATTGCGTGCTACGTGACTATCAGGGGTGAGAAGGCGATGCAGCTGCTGGAGAGTGGCCTGAAGGTGAAGGAGTACGAGCTGCT
CAGGAGGAACTTCAGCGACACCGGCTGCTTTGGCTTCGGTATCCAGGAGCACATCGATCTCGGCATGAAGTATGATCCATCTACCGGCATCTACGGTATG
GACTTCTTCGTGGTGCTCGAGCGTGCTGGGTACCGCGTCTCCCGCCGCCGCAGGTGCAAGGCCCGTGTCGGTATCCACCAGAGGGTCACCAAGGAGGACG
CCCATGAAGTGGTTCCAGGTCAAGTATGAGGGTGTCATCCTCAACAAGTCCCATGCGAGCTAAGAAGGACGTAGCTCTCTTTAGACCTTGAGTTAATTAA
GTTCACCTGGTTGCTGGGATATGTATGTTACCTAGAAACCAAAAATGCTTTGTCAGTTTTGCCTGTACTCAAGCTGGATGATTTCTGTTTGATGCGCACT
TTCGTCTAAGAGGCTCTCTTCTGTTTT
page-top