Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig35
Contig Information
Length 339 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh1j06    rwhsh1j06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_03369 [Oryza sativa Indica Group]
Score 80
Evalue 1.56884
Total Hit Count 4
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig35
GAGGAGCAAATGGAAATGGAATGCACGCACAGGCCAACCCGTTCGGAACCGCCCAACTCCTATAGCTTCACACCATACAGTCACAGTTACATACACGTTG
CGCAATGCCAACCCAGATTCCAGAGCTACATACTGCGTGTTGAGAAGTTCAATCTCCTTGCGTCACAAATGTCAATGCCAGCTTTGTCCCGCCATATCTC
GGGCGTTGGCTGCTTGATCAATTCTTGTATAGCCTGTGCTTATTAAATTTTGGTGTATATTTTTTCACCGCTTTGACGGTTATGGAAGACCCTCTTTGTA
AAGGATTTCGTTATTGCTGATGCAGCATCAAAAAAAAAA
page-top