Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig33
Contig Information
Length 330 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9m13    rwhsh9m13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37510 [Oryza sativa Indica Group]
Score 143
Evalue 7.85623e-08
Total Hit Count 42
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig33
CGAGGGAGCTCTACGGCGACGAGGCGTCCGACTCCGAGAGCCCCAAGAAGGTTGGCTATGTCATCATCCCCGGCGTCGAGGCCTACGACGGTGGTAAGAA
CTAGATTCTAGGGTTTCCCTTTCCCAGGAGTGGCAAGTTCCATGATATGCCAGTGTGCTGCTGTTTGTGTGTTGCGTAATAATCCGTAAAATGCCTCTGT
GATGTGTAGTTGGGCCGTAGTAGTTCTGTGCCCTCCATGTGAATACGCTCTTGATGCGAACTTATGCTGTGAAATGTGCTTCGTTTCTAGTAATGAACTT
ATGGATGAATGTCCGTCCTGAAAAAAAAAA
page-top