Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig32
Contig Information
Length 592 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh9e22    whsh9e22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0655500 [Oryza sativa (japonica cultivar-group)] >gi|113612033|dbj|BAF22411.1| Os07g0655500 [Oryza sativa (japonica cultivar-group)]
Score 199
Evalue 4.33549e-14
Total Hit Count 12
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig32
GAGGGGACGGTCCACCTGGTCCATGCACCGACTGGTCGATGCCGCCTAGGAGATCCAAGTATCCTCCTGGCTCCAGACATTCAATGGAGCCTCCAATGTC
CCATGAAGGAGGTTGGAGGAGGCACGGAAGACACAATAATGATAGATTCCATAGATGAAGGGCCGCAGAAGCTTTGTGTCTCGACCATACTGAGCCTCAT
CTGCGATTAACAGTACAATGGTTTCCAGACGAGGGATAATTCCTGACAATTTTAATGGTTATAGATTTTAGTTTTCTTTCTTTTTGCCTTTGGTGGGCCG
TGAAGGGGATCTTCATTGTCTCCATTCAGGGACGGGCTTAGCATGAAATCTCTTTGCAAAAGAAGAGATGGAACAGGCCCTGGTTGTACAAATGTATGTC
ACCATTCTTCTGCAAATGCAGAAACGGAAGGGACTTCAATGGTGCGTGGAGCTGTTCTGTAACAATCTAGTTAGCCTTACAGTCTACTGTGTTGTTGAGA
AATTCTTCACTATTGATTTCCATTCAAATATCCCTTTTGTAATCCAACTGTCATTTCAAGCACCTTACTGAAACTGTCTGACATTGTATAAA
page-top