Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig31
Contig Information
Length 176 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9d22    rwhsh9d22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09579 [Oryza sativa Indica Group] (no hit)
Score 164
Evalue 7.33743e-10
Total Hit Count 0
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig31
ATTCGGACGAGGGTTAATACTAGTCGGGTCTTTTGATGTCTTCTGTGCTTTGTTTTTGCTTTTTGAGTCTACTGAAACCGCAGTACTTGTGCGGTTTCCT
CTATCCAGTTATTTTTTAGTACTGCATCTGTAAAACCATATGTGATCCTAGTACCCTGTTCTTCCCAAAAAAAAAA
page-top