Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig28
Contig Information
Length 300 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh9m01    whsh9m01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloroplast inositol phosphatase-like protein [Triticum aestivum]
Score 97
Evalue 0.0169138
Total Hit Count 8
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig28
GCCAAGCCGAATGAGGCTGTTGCAAAATTCGATGGAAGCGCTTATCCCTTGAAGCATTAACTCAACCTTTCCCCAGAGGACAGCTTGTCCGGATAACAGA
TATTAACAGTTATACACATCTGGATAGCGTTGAGAACTATCGGGGGCATCTTTGGCTGCTCTTCGCGCGAGTGTAGTACTCCGCCGTACAAAAAGATCCA
GATTATTCGTAGTATTGAGTTTGGTATTTTGTAATTTCTCCTTGTCTGTGTTCGAATGGATCGTTTTCTTCACTTATTTGACAATATATGAAAAAAAAAA
page-top