Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig27
Contig Information
Length 349 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9e17    rwhsh9e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_25962 [Oryza sativa Indica Group]
Score 124
Evalue 1.26926e-05
Total Hit Count 8
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig27
GAGGGGTGGGCGTGGTGCTGGAAGACGACGACCAGTGGCAGGCGCCCGCGCACTGCTTCCTGGATGAAGCAGCCCACGGGACCAACGAGGATGACGACCA
TCTGGATGAATGGCAGGCGGCCATGCTATTCAGGAAGTTGGCTGGAGCTGCTGCCGCGTACTGAACATGTCTGAATCTGAATATATAAATAAATATATGG
TGTGTGTTTGGCTGGCGAGCCACTCGTACATTACACGGGTGAACTATGTAATCTCGGGTTAGACCGATCGTGCTTGTGTTATCTTGTCTCTTGTCTGTTA
CTCGGTGTGTATATTTTGTAATGTAGAGCCCGGGGTACTCCCCTTTTCC
page-top