Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig25
Contig Information
Length 594 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9f11    rwhsh9f11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_31293 [Oryza sativa Indica Group]
Score 587
Evalue 4.48959e-59
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig25
GAGGGACGAGTTCCTGGTGAGCCGGGACCCCGAGCAGATGCAGGCGGCCGTGGGCACCATGGACGGCATCCTCGACACGGTGTCGGCGTGGCACCCCATC
TCGCCGCTGTTCGCGCTGATGAAGCCGATGGGGCAGATGGTGTTCGTGGGCGGGCCGACCAAGCCGCTGGAGCTGCCGGCGTACGCCATCGTGCCGGGCG
GGAAGGGCATCGCCGGGAACTGCGTCGGCGGCATCAGGGACTGCCAGGCCATGCTGGAGTTCGCGGCGAAGCACGGCATCACCGCCGAGGTGGAGGTGAT
CAAGATGGACTACGTCAACACGGCGCTCGAGCGGCTCGCCAAGAACGACGTCCGCTACCGCTTCGTCATCGACGTCGCGGGCAGCCTCGGCTCAACATCG
TGAGCTGGAATGGCCACCTTGTTGATACTAGCTGCGTTAATTTTCTTCGGCGAATGCGTGCAGATTTAGACCGAGCAGACATAGAACACTGTCCCACCTC
CAGTTTTTTGGAGTTACAGCAGCAAAAACGGTGCACTGTTTTATGGATGTTCGCATATCAGGTTTCGGAAATTTTTGACTTTTTCCTGAAAAAA
page-top