Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig24
Contig Information
Length 258 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9l15    rwhsh9l15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit heat shock transcription factor [Entamoeba histolytica HM-1:IMSS] >gi|56469412|gb|EAL47163.1| heat shock transcription factor, putative [Entamoeba histolytica HM-1:IMSS]
Score 76
Evalue 4.68421
Total Hit Count 2
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig24
GAGGCCTCGTGCCGAATTCGGCACGAGGGAAGAGTCTTCCATGGGTTGAATGATGTTTGGCTTCCTGAGTTTCCGATGTGTGTCCTGTTAACAGAAATAC
TAATAGAGCGTTGCCCTGTAATCCTAGTCCTGTTTTCCCTTCACGTATGGTTTTCATCCGTTCCCTGTCAATATTTACTGTATCTACATGCTCATCTCGT
GTGATTAAATGGAAGAGACGTGTGCATGATTTTCTTTTGGTCGGATTGAAAAAAAAAA
page-top