Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig22
Contig Information
Length 495 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh9e23    whsh9e23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein transport protein Sec61 beta subunit [Zea mays]
Score 208
Evalue 2.40804e-15
Total Hit Count 142
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig22
GGAATTTCACGCACCAGGTTTGGATTTGGAAGCCAGACGGACAAGAGGAGAGGAGGATCAGCGAGTGCGAGGCCGAGTTCATCAGGTAGGTAAGACAAGA
TGGTGGCTAATGGTGACGCACCTGCAAGAGGGAGTGCAGCTGCAGCTGCAAGCCTGCGCCGACGTAGAACCACCGGTGGTGGTGCTGCTGCTGGAGGTGG
TGGTGGTGGTGCCAGTACAATGCTTCAGTTCTACACCGATGAGGCTGCTGGGCGCAAGATGTCCCCAAATGCTGTTCTGATCATGAGCATAGGGTTTATT
GCCGTCGTTGCCGTACTCCATGTTTTCGGCAAGCTGTACCGCACCCCTAATTAGCTTCCATATATGAAAACTGAGTTTATGTGTCTATGAATAGCGAAGT
CGTAGACTTTGCATAGCAAATGACTGTCGGGCCCTGGAAAGATTTACCTTGTACTCCTATAATACTGAGATGTTATTGTCGAACCAAAAAAAAAA
page-top