Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig21
Contig Information
Length 575 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9l03    rwhsh9l03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38575 [Oryza sativa Indica Group]
Score 215
Evalue 5.72014e-16
Total Hit Count 22
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig21
GAGGGTGGATTATTTGGTGAGGTACAACACCTGTTTCGACAGCGAACAGGAAGGCGACCATCCCCTCACCGAAGCTGAAGAGGTATTCTTGGATCGGCTG
GAAAGCCAACTCGAAGACGACAGACCAGAGGGAAGCACAAACAAGCAGCGCGAAGTAAGCTCCGAGATTGTGGAAATGGAGGACGATCAACCTGAACTGA
AATCTGAAACCAAGGCACTGGAGGACATACATGAAGAAGAAGAAGAAGGTGCAGAGTTATTGAAATGATAAAGAGTCTTGTGTTCTTGGGCAGGTAGATC
TTGTGGTTTTTACTCTCTGGTGGATTGAGTTTGTCAACATCTGGTTGAAATGTATTGCTTGTAGTGCCTGAACTTAACTCTGCTGGTGCTGTGATATGGC
CATGTGGGTCATTCATATCTGTCCTGCCGTAGGACACCACCAGGATTCACTGCTGTATGGTCAAACAGTGTTGTATGGAAATGACTGCATTAGTGTGCAC
TCGATGTTATTCTATCTGTACAAAAAATCTTCTTTTATTTTTTCATATGTGACTTGATTTCTAATTGTTAAAAAA
page-top