Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig19
Contig Information
Length 307 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9k17    rwhsh9k17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 102
Evalue 0.00443483
Total Hit Count 72
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig19
CGAGGGGCGCCTATCACACCGTTTTCGACTTCGGCGAGAGCAGGATTGGGTTCGCCAAATCCGCATGAGGACTTGGTGTATCAGGGCTCAGGGCCGGTAT
TGTACATACTGCAAGCACGTGCAAGTTGCAAGGGCAACAATAAACTTATACGGAGTATTAGTAGAAAGGAACAAATGAACTTGCCACCAGCATTTGTATA
GCTATTTGCTATGTATGGCTTGATATGGAGCTGCAGACAGCACACACGATGACACGACACGAGGTTGATGTAATAAGCGCGATGAGAATCATGGTTTAAA
AAAAAAA
page-top