Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig18
Contig Information
Length 628 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9k15    rwhsh9k15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phytoene desaturase [Triticum aestivum]
Score 843
Evalue 1.07038e-88
Total Hit Count 381
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig18
CGAGGAGAACACGTATGACCACCTTCTTTTCAGCAGGAGTTCACTTTTAAGCGTTTATGCAGACATGTCTTTAGCGTGCAAGGAGTACTATGATCCAAAC
CGTTCGATGCTGGAGTTGGTTTTTGCTCCAGCAGAGGAATGGATCGGACGGAGTGACACCGAAATCATCGAAGCAACTATGCTAGAGCTAGCCAAGTTGT
TTCCTGATGAAATCGCTGCTGACCAGAGTAAAGCAAAGATTCTTAAATACCATGTTGTGAAGACACCGAGGTCCGTTTACAAGACCGTCCCGAATTGCGA
ACCTTGCCGACCTCTGCAACGATCACCGATCGAAGGGTTTTATCTGGCCGGCGATTACACAAAGCAGAAATACTTGGCTTCCATGGAGGGTGCGGTTTTG
TCAGGAAAGTTTTGTGCTCAGTCCATAGTGCAGGATTCTAAGATGCTGTCCCGCAGGAGCCAGGAGAGCCTGCAATCCGAAGCCCCCGTCGCCTCCAAGT
TGTAGCTAGTTAGCGCGATTCAATTTTTTTTAGCGTTTCCTATATGTCATTGTCACATTGTTGTAGAGTCCACCAGTGAATTGAGCTGACAGCCACATAT
TGGGACAAAAAGGGAGATTTGTAAAACA
page-top