Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig17
Contig Information
Length 507 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9k01    whsh9k02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19367 [Oryza sativa Indica Group]
Score 362
Evalue 3.49181e-33
Total Hit Count 348
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig17
CCATGCCTAAGATGCTTATGGATGGGGCTATTGAGTATGAAGATGGTACTCCTGCAACTGAAGCCCAGATGGGCAAGGATGTTGTGTCATTCTTGTCGTG
GGCTGCTGAGCCTGAAATGGAAGAGAGGAAACTGATGGGTGTCAAATGGATCTTCCTACTGTCACTTGCTCTTCTCCAAGCCGCATACTACCGTCGCATG
AGGTGGTCCGTCCTCAAGTCCCGCAAGCTGGTCCTGGACGTCGTCAACTGATGACCATTGTTTCTTCTTTTTATTGCAACGTTGAGGCTTTAAGCAGAAG
CGATTGAAATAATGGCTTCCGTTGTATATTTTTGCTACTAGGGTTGTCTCCCATCATACCTTGGGTACAATCTCTTTTGTTTTCTTCCTCTGCTGCAAAA
GCATTTCTCCAAGGAGCAGTTATTTTCAAATATTTTTTGCCAGTTGATACCTGATGGTACCAACATACTTCTAACAGAAGAGTTGATAAATGCTTTAAAA
AAANAAA
page-top