Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig16
Contig Information
Length 247 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh9k10    whsh9k10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative deoxyuridine triphosphatase [Oryza sativa (japonica cultivar-group)] (no hit)
Score 182
Evalue 1.40119e-12
Total Hit Count 0
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig16
GCCAGGACTTCCTTCAGAGGCACTGATCGATGGTGAAGATGGCCGGGGGCTTACATTAGTTATTTTTTGGACGGTCAAAAAATGAAGCGATTTGAGTGAA
TAATCGATCGACCGATCCTCCGTACGTCGATTGCAGGCGCATGCTATTCATGCGTGCATGTGTGACAAGATTGCACCGAATAAGTTGTCGTAATATTTAT
GTACTCATAAAAAAAATGCTTAAAAACGGGCACTCGTAAAAAAAAAA
page-top