Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig11
Contig Information
Length 218 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh9g13    whsh9g13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mitochondrial NADH ubiquinone oxidoreductase 29 kDa subunit [Zea mays]
Score 192
Evalue 1.60662e-13
Total Hit Count 14
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig11
GCCAAAGCTCGCTGTGGCCATCAATGATCTTATGCAAAGCCATTTCTCGGAGTTTCTCCCATACTCTAATGCTTATTTGGAGGTAGAGAAGCTGAAGAAG
TCGTTTTCAATTCCTTTGTAAGATCATGTTTTCCCTTTCCCAGCAAATGAGTGAGGAAATAAAGCAGCCCGAATACTAGAATCTCTGTATTCAATCTAAT
TTGTAGCCAAAAAAAAAA
page-top