Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig10
Contig Information
Length 224 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9i18    rwhsh9i18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Methionine S-methyltransferase; AltName: Full=AdoMet:Met S-methyltransferase; AltName: Full=Hv-MMT1 >gi|7634680|dbj|BAA94795.1| S-adenosyl-L-methionine: L-methionine S-methyltransferase [Hordeum vulgare subsp. vulgare]
Score 107
Evalue 0.00119129
Total Hit Count 2
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig10
CGAGGGCGATGGAGTGCATCGCCCGGTTCAGGGAGCTGGTCCTGGGAGGCAGTCCTCAGGTGAATGGTAGCAACTAGGATTGTTGGGGTGGGTCAAATGG
GTGAAGAAAAACTGTAAAACCTGAAGAGATGAGATGTAACCAACTCTTATCTTTCTTTACCTGTTTGAAATACTTTGTTTCAAATCGAAATGGAATAAAA
GCACGTAATCTCTGAAAAAAAAAA
page-top