Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig8
Contig Information
Length 463 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh9h23    whsh9h23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to Cyclin M3 [Monodelphis domestica]
Score 74
Evalue 7.74208
Total Hit Count 1
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig8
GCGCCGCCGCCTTCGCCAGGGGCTATGGTTCCCGCAGTCGCCGTCGGGGCTGCTCTCACCGTCCGGATTCTTTCCATTGCTGAGCCCACGGTGGAGAGAT
ATGTAGCATGCGTCAGCAGACGCCCCTGTAACATTTGACGGTAGGGAGGTAGCTACTGTGATGGGAATTGGTTCATCCGACGGAGGTGAAACAGGTGGGT
TGTAGCTCTCGACACCATTATTTGTTGCTGTTAATTGCTGCTGTGCGATTAGCATCAGTCTGTAAGGCTTCGGTAAAGGCTGTTGGTTACATATTTGTAA
TTGTATAACTGGGGAAAATTTCAATTTATTCACTTTCTTAGCTGCAAAAGGAGGACAGTAAGAACTGGGAATGTTGTAGTGTAGATTCTTGAGTGGCTAG
GCTTGAAACATGTAACTGTAATTTTAGTTCAAGAAAGATGAGTTCTTTCTGACAAAAAAAAAA
page-top