Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig7
Contig Information
Length 784 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9h18    rwhsh9h18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0354600 [Oryza sativa (japonica cultivar-group)] >gi|38346871|emb|CAE02220.2| OSJNBb0002N06.11 [Oryza sativa (japonica cultivar-group)] >gi|113564112|dbj|BAF14455.1| Os04g0354600 [Oryza sativa (japonica cultivar-group)] >gi|215686875|dbj|BAG89725.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218194653|gb|EEC77080.1| hypothetical protein OsI_15480 [Oryza sativa Indica Group]
Score 389
Evalue 7.42874e-63
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig7
CCTTCCTGTCGTCATTATTCGACCTACCATGGTAACCAGCACTTTCCAAGATCCATTTCCAGGTTGGATAGAAGGGGCGAGGACAATTGATGCTATGATT
GTCGCCTACACTGAGCAAGCATTCCCATGTTTCGTAGGTGATCGCAAAGACACAATGGATGCAGTTCCTGCGGACATGGTGGTAAATGCAACGCTGGTAG
CCATGGCTGTTCATTTGAATGAGAAAGGACAAGTCATTTACAACGTGTGCTCAGCACTCCAAAACCCCATTGACGGGTTATGGCTTAGAAGACGCATGTT
GGGATTACTTCTCCATATATCCTCGTATACAGAATGGGAAACCCCTCAAAAACAAAAGGCCATACGTGTTTAAGAGATTCGCTTTATTCCGCGCATATCT
GATACTGGTGTATAAGCTACCACTTGAGATGTTACATGCCGTGAGCCTGTTATTTTGTGGGTTGTTTTCACAATATTACAATAAGCAAAACCGAAGATAC
AATTTCTTAATGCTCTTGGTCAAGCTGTATGCGCCATATGCCTTCTTCAAAGGATGCTTTGATGACACGAACATGAGGAGGTTGAGGATGGAAGTAAAAA
TGGATGGCAATGCTAGTGACATATTTAACTTTGATCTCAAATCTATGGACTGGCACACGTATCTCCTGAATGTACACGTCCCAGCTGTGCTAAAGTATGG
ACGCAAAAATAAGGGAAGCGTATAAGAAAGAAAGGGACCATTCTATTCATGAGAAAGAGAACAAGCATCTTGTCCAACAAAAAT
page-top