Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig6
Contig Information
Length 534 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh1g14    whsh1g14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216991 [Zea mays] >gi|194697314|gb|ACF82741.1| unknown [Zea mays]
Score 286
Evalue 2.67837e-24
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig6
GGGAAAACATAAAATCCAGGGAATAGGACCAGGATTCTTACCTGAGATCTTGGACACCTCGATCATCGATGAGACGGTCACCGTGACCACCGAGGACGCA
ATGACGAATGCGAGGAGGTTGGCAATGGAAGAAGGCCTGCTTGTGGGCATATCTTCTGGGGCAAACCTGGCAGCTTGCTTGAAGGTTCACATCTCATATC
TTTTTTTTTTCTGTATTAATGGAAAATGGGGATACCTGGTTTGAATTTTTGTTTGCATTTAAAGAAAAAAGAAATGGGTTATTAACTTTGTTTTCAATTT
TGTTATACTTTCCTTCTTTGATATTACTAACTCTTCCGAGTCAAATGTATCTTCAGGTCGCAGCAAGAGAAGAGAACAAGGGGAAGATGATTGTGACCAT
GTTCCCGAGCGGGGGCGAGAGATACATGAACTCTGACCTCTTTGCAGCTGTAAGAGAGGAGTGTATTGCCATGACCTTTTGATCTCACATGCTACAAATG
AATGAATGCCTATGAATGTGTTACTAGATAATCA
page-top