Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig5
Contig Information
Length 204 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh9g17    rwhsh9g17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit inner-membrane translocator [Rhizobium etli CIAT 894]
Score 76
Evalue 4.59865
Total Hit Count 1
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig5
CGAGGCTGGCATACAACGGACGCTTTCCTGGGGCGTGCTGCTGAATGAATTCCTTTTGCTGTATACTTGCTTGCTTGGTTTTTGCTATTTATTATGTGGA
GACAATTGGGGTCTTGTTATGTACATGAGAAACGGGATATAGGCCGGTCGTTGGGTGGTTGCCGAATAATAATATGTCCCGAGGTGTTTGTTTCAAAAAA
AAAA
page-top