Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig4
Contig Information
Length 230 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh9g20    whsh9g20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_003394 [Oryza sativa (japonica cultivar-group)]
Score 105
Evalue 0.00201846
Total Hit Count 9
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig4
GGTCTTCGAGAAGACAGATGGCACATGGTATATCTGCATTCACCATGCTTCACACATTGAAGAATGAAATGACACTTTCTGGTGGTTTATGTTGTATATT
CCATAGCCGTTGGCGATGTCATTCCATGTGGGGTTATATATGACTGGAATTTACTATTGCTCATGGACTTGACACCTCAAGGAGGTGAAGTCATATTCCA
TATCCAAGCTACTTAAACATAAAAAAAAAA
page-top