Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig104
Contig Information
Length 1035 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv9n14    rwhkv9n14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=UTP--glucose-1-phosphate uridylyltransferase; AltName: Full=UDP-glucose pyrophosphorylase; Short=UGPase; Short=UDPGP >gi|1212996|emb|CAA62689.1| UDP-glucose pyrophosphorylase [Hordeum vulgare subsp. vulgare]
Score 918
Evalue 5.4126e-97
Total Hit Count 266
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig104
TCTTGGAGATTGCCCAAGTCCCTGATGAGCATGTGAATGAATTCAAGTCGATTGAGAAGTTCAAGATATTTAACACCAACAACCTGTGGGTGAACTTGAA
GGCGATCAAGAGGCTTGTAGATGCTGAAGCACTTAAGATGGAAATCATTCCCAACCCTAAGGAAGTTGATGGCGTGAAAGTCCTGCAGCTAGAAACCGCA
GCTGGAGCAGCGATCAGGTTCTTTGAGAAAGCAATCGGCATCAACGTTCCCCGCTCAAGGTTTCTGCCCGTGAAGGCTACATCTGATTTGTTGCTTGTGC
AGTCTGATCTCTATACCTTGGTTGATGGCTACGTCATCCGCAACCCAGCCAGAGTGAAGCCATCGAACCCTTCAATTGAGCTTGGTCCTGAGTTCAAAAA
GGTTGCCAACTTCCTTGCCCGTTTCAAGTCGATCCCCAGCATCGTTGAGCTCGACAGCTTGAAGGTCTCTGGTGATGTCTCGTTTGGCTCTGGAGTCGTA
CTCAAGGGCAACGTGACCATCGCTGCCAAGGCTGGAGTCAAGTTGGAGATCCCAGACGGAGCTGTGCTCGAGAACAAGGACATCAACGGCCCTGAGGATC
TTTGAGCGACGCCCGCCGCCATCGCCAGTCGCATTCCCAGAAACCTTCCGGTCCTCCTTCGCTGAGTTAACCGTCCTGTAATTTTCGTGTGCATTCTGCT
GGGGTGTTGTCCTGGGATAGCCCCTTTACATAATAATTGTAATCCCCTCTGTGATGTTCATCTACACTTGTTCTTCCTGGGTGTGCCAGGGACGTAAAAT
TTCTTTTGGTTATATGATGCCCATAGTTTTCACATGCCTAAATTTGTTTCTTCTTTCGCCCTGCTGGGCTGTAAGAGTTGCTTTTTGCTAGAGTATTTTG
TGTCTCCTTTGGCAGTTGTGCCATGCGTAATCCACACTTGGTTGTGGCCATTTTAGATCACAAAGATACCGTCTATTGACAATCTTTCTCGTGGAACCTG
AATTGTTTGCTTCTATGCTCCCATTGTGCAAAAAA
page-top