Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig100
Contig Information
Length 397 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11h22    rwhkv11h22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 82
Evalue 0.941248
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig100
CTTCAAGCTGCTCTTGCTAGTCATGGCCAAGGACACGATGGTTTACTTTGATCTGTTCTAAGTGCCTCCATGGTAGTAGTTTCTCGAGAGATGCCACCAG
GAACCCGCCTATCTGTACACTGGAATAATCGTCAAGGTGGACAAAATGCCCGACCGCTGGTTCTTCTTCTGTCTCGCATACCAAGTTGCTGCGTTTTTCT
TTTTCCTCTTATTATTTCTGTGATTGATTAATGGACAAGTAATGTCCAGTTGTCACAGAGTACTAGCTTATATGGGAGCAACGTTTGCCCTAGTTTTGTA
ATAATGGTATATATCAACCCTTGACGTTCTGTCGTTTATTGCTCTTGTTCTGCAAAAAAATTAGTAAATGCCATGTTTACCTGTTGCAAAAAAAAAA
page-top