Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig96
Contig Information
Length 707 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv11h09    rwhkv11h09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain 4, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390381|pdb|2J37|4 Chain 4, Model Of Mammalian Srp Bound To 80s Rncs
Score 517
Evalue 8.7355e-51
Total Hit Count 451
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig96
CGATTCGGCACGAGGGCATCGCCTCGCGCCCGCACCCCAGGAAGGTAAGTTCAAGAGGCTTTTCTGAGAAGCTCAAATGGCTCCCAAAGTTGCTGTTGCC
AAGAAGGGCGATGCCAAGGCCCAGGCCGCCAAGGTTGCCAAGGCTGTGAAGTCTGGGTCAATCAAGAAGACGGCAAAGAAGATCCGCACTTCTGTGACAT
TTCACCGCCCCAAGACCCTGTCCAAGGCCAGGGACCCCAAGTACCCCAGGATCAGCACCCCTGGAAGGAACAAATTAGACCAGTACCAGATCCTCAAGTA
CCCGCTTACCACTGAGTCTGCGATGAAGAAGATTGAAGACAACAACACCCTTGTCTTCATTGTCGACCTCAAGGCCGACAAGAAGAAAATAAAGGCTGCT
GTCAAGAAAATGTATGACATTCAGGCCAAGAAGGTTAACACCCTCATCAGGCCTGATGGCAAGAAGAAGGCGTACGTGAAGCTGACACCAGACTACGATG
CTCTTGACGTGGCCAACAAGATCGGCATCATATAAGCCAGAGGGAGGGTCCTGCAGTAGGCGCTTGTGTCGTGGTTTCTTATGTTATTGGAATTTTGTAG
TTGTTACTTAGCAAAGGGCCTTAGTGGCTCCATTGCCTACCATATCGCTGCACACTTTCATGAATTTGATGCAATCGAAGTGACTTGTGTTGATGCTAAA
AAAAAAA
page-top